stem-loop reverse transcription primers Search Results


90
Promega stem-loop primer reverse transcription reaction
Stem Loop Primer Reverse Transcription Reaction, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/stem-loop primer reverse transcription reaction/product/Promega
Average 90 stars, based on 1 article reviews
stem-loop primer reverse transcription reaction - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Promega stem-loop reverse transcript primer and m-mlv reverse transcriptase
Stem Loop Reverse Transcript Primer And M Mlv Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/stem-loop reverse transcript primer and m-mlv reverse transcriptase/product/Promega
Average 90 stars, based on 1 article reviews
stem-loop reverse transcript primer and m-mlv reverse transcriptase - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Beijing Genomics Institute Shenzhen stem-loop reverse transcription primer
Stem Loop Reverse Transcription Primer, supplied by Beijing Genomics Institute Shenzhen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/stem-loop reverse transcription primer/product/Beijing Genomics Institute Shenzhen
Average 90 stars, based on 1 article reviews
stem-loop reverse transcription primer - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Sangon Biotech downstream and reverse transcription primers of stem-loop method
Downstream And Reverse Transcription Primers Of Stem Loop Method, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/downstream and reverse transcription primers of stem-loop method/product/Sangon Biotech
Average 90 stars, based on 1 article reviews
downstream and reverse transcription primers of stem-loop method - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Ribobio co primers for stem-loop reverse transcription pcr (rt-pcr) and quantitative pcr (qpcr)
Primers For Stem Loop Reverse Transcription Pcr (Rt Pcr) And Quantitative Pcr (Qpcr), supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers for stem-loop reverse transcription pcr (rt-pcr) and quantitative pcr (qpcr)/product/Ribobio co
Average 90 stars, based on 1 article reviews
primers for stem-loop reverse transcription pcr (rt-pcr) and quantitative pcr (qpcr) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
MiRXES Inc modified stemloop reverse transcription primer pools
Modified Stemloop Reverse Transcription Primer Pools, supplied by MiRXES Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/modified stemloop reverse transcription primer pools/product/MiRXES Inc
Average 90 stars, based on 1 article reviews
modified stemloop reverse transcription primer pools - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Ribobio co speci c stem-loop reverse transcription primer set
Speci C Stem Loop Reverse Transcription Primer Set, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/speci c stem-loop reverse transcription primer set/product/Ribobio co
Average 90 stars, based on 1 article reviews
speci c stem-loop reverse transcription primer set - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Bioteke Corporation stem-loop reverse transcription primer (sequence: 5′- gttggctctggtgcagggtccgaggtattcgca ccagagccaactcaaca-3′)
Stem Loop Reverse Transcription Primer (Sequence: 5′ Gttggctctggtgcagggtccgaggtattcgca Ccagagccaactcaaca 3′), supplied by Bioteke Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/stem-loop reverse transcription primer (sequence: 5′- gttggctctggtgcagggtccgaggtattcgca ccagagccaactcaaca-3′)/product/Bioteke Corporation
Average 90 stars, based on 1 article reviews
stem-loop reverse transcription primer (sequence: 5′- gttggctctggtgcagggtccgaggtattcgca ccagagccaactcaaca-3′) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Ribobio co customized kits containing the stem-loop reverse transcription primer and mir-specific molecular beacon probe
Customized Kits Containing The Stem Loop Reverse Transcription Primer And Mir Specific Molecular Beacon Probe, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/customized kits containing the stem-loop reverse transcription primer and mir-specific molecular beacon probe/product/Ribobio co
Average 90 stars, based on 1 article reviews
customized kits containing the stem-loop reverse transcription primer and mir-specific molecular beacon probe - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Ribobio co stem-loop reverse transcription primers and pcr primers for the genes of interest
Stem Loop Reverse Transcription Primers And Pcr Primers For The Genes Of Interest, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/stem-loop reverse transcription primers and pcr primers for the genes of interest/product/Ribobio co
Average 90 stars, based on 1 article reviews
stem-loop reverse transcription primers and pcr primers for the genes of interest - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Promega stem-loop reverse transcript primer
Stem Loop Reverse Transcript Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/stem-loop reverse transcript primer/product/Promega
Average 90 stars, based on 1 article reviews
stem-loop reverse transcript primer - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Ribobio co gene-specific stem-loop primers for reverse transcription
Gene Specific Stem Loop Primers For Reverse Transcription, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene-specific stem-loop primers for reverse transcription/product/Ribobio co
Average 90 stars, based on 1 article reviews
gene-specific stem-loop primers for reverse transcription - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results